ATF2 cDNA ORF Clone, Human, C-His tag

Cat: HG11599-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ATF2 Reagents

CRO Services

Product recommended


All ATF2 Reagents

ATF2 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Description
Full length Clone DNA of Human activating transcription factor 2 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATF2 cDNA ORF Clone, Human, C-His tag Alternative Names

CRE-BP1 cDNA ORF Clone, Human;CREB-2 cDNA ORF Clone, Human;CREB2 cDNA ORF Clone, Human;HB16 cDNA ORF Clone, Human;TREB7 cDNA ORF Clone, Human

ATF2 Background Information

Activating transcription factor 2, also known as ATF2, is a member of the leucine zipper family of DNA-binding proteins that binds to the cAMP response element. Its activity is enhanced after phosphorylation by stress-activated protein kinases such as c-Jun N-terminal kinase and p38. ATF2 has been found to be a target of the JNK signal transduction pathway and mediate adenovirus E1A-inducible transcriptional activation. ATF2 is also been reported playing roles in TGF-β signaling pathway. It has been shown that the transcription factor ATF2 is bound by a hetero-oligomer of Smad3 and Smad4 upon TGF-β stimulation. Studies indicate that ATF-2 plays a central role in TGF-β signaling by acting as a common nuclear target of both Smad and TAK1 pathways. 

Full Name
activating transcription factor 2
References
  • Livingstone C, et al. (1995) ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14 (8): 1785-97.
  • Gupta S, et al. (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science . 267 (5196): 389-93.
  • Sano YJ, et al. (1999) ATF-2 Is a Common Nuclear Target of Smad and TAK1 Pathways in Transforming Growth Factor-_ Signaling. The Journal of Biological Chemistry. 274: 8949-57.
  • ATF2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ATF2 cDNA ORF Clone in Cloning Vector, Mouse MG50262-M
    ATF2 cDNA ORF Clone, Mouse, untagged MG50262-UT
    ATF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50262-ACGLN
    ATF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50262-ACG
    ATF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50262-ANG
    ATF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50262-ACR
    ATF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50262-ANR
    ATF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50262-CF
    ATF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50262-NF
    ATF2 cDNA ORF Clone, Mouse, C-His tag MG50262-CH
    ATF2 cDNA ORF Clone, Mouse, N-His tag MG50262-NH
    ATF2 cDNA ORF Clone, Mouse, C-HA tag MG50262-CY
    ATF2 cDNA ORF Clone, Mouse, N-HA tag MG50262-NY
    ATF2 cDNA ORF Clone, Mouse, C-Myc tag MG50262-CM
    ATF2 cDNA ORF Clone, Mouse, N-Myc tag MG50262-NM
    ATF2 qPCR Primer Pairs, Mouse MP200287

    ATF2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ATF2 cDNA ORF Clone in Cloning Vector, Human HG11599-M
    ATF2 cDNA ORF Clone, Human, untagged HG11599-UT
    ATF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11599-ACGLN
    ATF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11599-ACG
    ATF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11599-ANG
    ATF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11599-ACR
    ATF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11599-ANR
    ATF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11599-CF
    ATF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11599-NF
    ATF2 cDNA ORF Clone, Human, N-His tag HG11599-NH
    ATF2 cDNA ORF Clone, Human, C-HA tag HG11599-CY
    ATF2 cDNA ORF Clone, Human, N-HA tag HG11599-NY
    ATF2 cDNA ORF Clone, Human, C-Myc tag HG11599-CM
    ATF2 cDNA ORF Clone, Human, N-Myc tag HG11599-NM
    ATF2 qPCR Primer Pairs, Human HP101660
    info info
    添加购物车成功! 添加购物车失败!