Быстрый заказ

Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ASTN2 Информация о продукте «Клон cDNA»
Размер кДНК:1323bp
Описание кДНК:Full length Clone DNA of Homo sapiens astrotactin 2 with C terminal HA tag.
Синоним гена:bA67K19.1, ASTN2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13428-ACGRBS15400
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13428-ACRRBS15400
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13428-CFRBS13340
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13428-CHRBS13340
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13428-CMRBS13340
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13428-CYRBS13340
Человек ASTN2 Джин клон кДНК в вектор клонированияHG13428-GRBS5130
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13428-NFRBS13340
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13428-NHRBS13340
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13428-NMRBS13340
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13428-NYRBS13340
Человек ASTN2 Джин ORF экспрессии кДНК клона плазмидыHG13428-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.