After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ASRGL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC064963
Размер кДНК:543bp
Описание кДНК:Full length Clone DNA of Homo sapiens asparaginase like 1 DNA.
Синоним гена:ALP, ALP1, CRASH
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15233-ACGRBS15400
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15233-ACRRBS15400
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15233-ANGRBS15400
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15233-ANRRBS15400
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15233-CFRBS13340
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15233-CHRBS13340
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15233-CMRBS13340
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15233-CYRBS13340
Человек ASRGL1 Джин клон кДНК в вектор клонированияHG15233-GRBS5130
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15233-NFRBS13340
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15233-NHRBS13340
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15233-NMRBS13340
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15233-NYRBS13340
Человек ASRGL1 Джин ORF экспрессии кДНК клона плазмидыHG15233-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15233-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».