Быстрый заказ

Text Size:AAA

Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ASPH Информация о продукте «Клон cDNA»
Размер кДНК:612bp
Описание кДНК:Full length Clone DNA of Homo sapiens aspartate beta-hydroxylase with C terminal His tag.
Синоним гена:AAH, BAH, HAAH, JCTN, junctin, CASQ2BP1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15153-ACGRBS15400
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15153-ACRRBS15400
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15153-ANGRBS15400
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15153-ANRRBS15400
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15153-CFRBS13340
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15153-CHRBS13340
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15153-CMRBS13340
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15153-CYRBS13340
Человек ASPH/Aspartate beta hydroxylase Джин клон кДНК в вектор клонированияHG15153-GRBS5130
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15153-NFRBS13340
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15153-NHRBS13340
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15153-NMRBS13340
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15153-NYRBS13340
Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмидыHG15153-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15153-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.