Быстрый заказ

Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ASPH Информация о продукте «Клон cDNA»
    Размер кДНК:612bp
    Описание кДНК:Full length Clone DNA of Homo sapiens aspartate beta-hydroxylase with C terminal His tag.
    Синоним гена:AAH, BAH, HAAH, JCTN, junctin, CASQ2BP1
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with ASPH qPCR primers for gene expression analysis, HP103780 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15153-ACGRBS15400
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15153-ACRRBS15400
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15153-ANGRBS15400
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15153-ANRRBS15400
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15153-CFRBS13340
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15153-CHRBS13340
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15153-CMRBS13340
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15153-CYRBS13340
    Человек ASPH/Aspartate beta hydroxylase Джин клон кДНК в вектор клонированияHG15153-GRBS5130
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15153-NFRBS13340
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15153-NHRBS13340
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15153-NMRBS13340
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15153-NYRBS13340
    Человек ASPH/Aspartate beta hydroxylase Джин ORF экспрессии кДНК клона плазмидыHG15153-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15153-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.