Быстрый заказ

Text Size:AAA

Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ASB9 Информация о продукте «Клон cDNA»
Размер кДНК:759bp
Описание кДНК:Full length Clone DNA of Homo sapiens ankyrin repeat and SOCS box-containing 9 with N terminal HA tag.
Синоним гена:ASB9
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14040-ACGRBS15396
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14040-ACRRBS15396
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14040-ANGRBS15396
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14040-ANRRBS15396
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14040-CFRBS13343
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14040-CHRBS13343
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14040-CMRBS13343
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14040-CYRBS13343
Человек ASB9 Джин клон кДНК в вектор клонированияHG14040-GRBS5132
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14040-NFRBS13343
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14040-NHRBS13343
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14040-NMRBS13343
Человек ASB9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14040-NYRBS13343
Человек ASB9 Джин ORF экспрессии кДНК клона плазмидыHG14040-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14040-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.