Быстрый заказ

Text Size:AAA

Human ART3 ORF mammalian expression plasmid, C-Myc tag

ПаспортОбзорыСвязанные продуктыПротоколы
Human ART3 Информация о продукте «Клон cDNA»
Размер кДНК:1170bp
Описание кДНК:Full length Clone DNA of Homo sapiens ADP-ribosyltransferase 3 with C terminal Myc tag.
Синоним гена:ART3
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

ART3 is an arginine-specific ADP-ribosyltransferase which belongs to the Arg-specific ADP-ribosyltransferase family. ART3 catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. It is expressed specifically in testis. ART3 pseudogene is located on chromosome 11. ART3 was identified as a susceptibility gene for non-obstructive azoospermia (NOA). It is a novel therapeutic target in the treatment of NOA.

  • Lévy I, et al. (1996) Human testis specifically expresses a homologue of the rodent T lymphocytes RT6 mRNA. FEBS Lett. 382(3):276-80.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200 (1-2):149-56.
  • Balducci E, et al. (1999) Selective expression of RT6 superfamily in human bronchial epithelial cells. Am J Respir. 21(3):337-46.
  • Size / Price
    Каталог: HG13542-CM
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
    Наличие2-3 weeksИнструкции по доставке
        Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.