Быстрый заказ

Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ARSB Информация о продукте «Клон cDNA»
    Размер кДНК:1602bp
    Описание кДНК:Full length Clone DNA of Homo sapiens arylsulfatase B with N terminal His tag.
    Синоним гена:ASB, G4S, MPS6, ARSB
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with ARSB qPCR primers for gene expression analysis, HP102353 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13674-ACGRBS16760
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13674-ACRRBS16760
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13674-CFRBS14710
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13674-CHRBS14710
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13674-CMRBS14710
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13674-CYRBS14710
    Человек ARSB Джин клон кДНК в вектор клонированияHG13674-GRBS5130
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13674-NFRBS14710
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13674-NHRBS14710
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13674-NMRBS14710
    Человек ARSB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13674-NYRBS14710
    Человек ARSB Джин ORF экспрессии кДНК клона плазмидыHG13674-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13674-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.