Быстрый заказ

Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ARSA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000487.4
Размер кДНК:1524bp
Описание кДНК:Full length Clone DNA of Homo sapiens arylsulfatase A with C terminal His tag.
Синоним гена:MLD, ARSA
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10449-ACGRBS16760
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10449-ACRRBS16760
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10449-CFRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10449-CHRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10449-CMRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10449-CYRBS14710
Человек Arylsulfatase A / ARSA Джин клон кДНК в вектор клонированияHG10449-MRBS5130
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10449-M-FRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмидыHG10449-M-NRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10449-NFRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10449-NHRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10449-NMRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10449-NYRBS14710
Человек Arylsulfatase A / ARSA Джин ORF экспрессии кДНК клона плазмидыHG10449-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family that is required for the lysosomal degradation of cerebroside-3-sulfate, a sphingolipid sulfate ester and a major constituent of the myelin sheet. Arylsulfatase A is activated by a required co- or posttranslational modification with the oxidation of cysteine to formylglycine. Metachromatic leukodystrophy (MLD) is a lysosomal storage disease in the central and peripheral nervous systems with severe and progressive neurological symptoms caused by the deficiency of Arylsulfatase A. Deficiency of this enzyme is also found in apparently healthy individuals, a condition for which the term pseudodeficiency is introduced. ARSA forms dimers after receiving three N-linked oligosaccharides in the endoplasmic reticulum, and then the dimers are transported to the Golgi where they receive mannose 6-phosphate recognition markers. And thus, ARSA is transported and delivered to dense lysosomes in a mannose 6-phosphate receptor-dependent manner. It has been shown that within the lysosomes, the ARSA dimers can oligomerize to an octamer in a pH-dependent manner. The ARSA deficiency leads to metachromatic leucodystrophy (MLD), a lysosomal storage disorder associated with severe and progressive demyelination in he central and peripheral nervous system. Additionally, the serum level of arylsulfatase A might be helpful in diagnosis of lung and central nervous system cancer.

Ссылки
  • Laidler PM. (1991) Arylsulfatase A--physico-chemical properties and the use of enzyme radioimmunoassay in medical diagnosis Folia Med Cracov. 32(3-4): 149-68.
  • Jean S, et al. (2006) Ethanol decreases rat hepatic arylsulfatase A activity levels. Alcohol Clin Exp Res. 30(11): 1950-5.
  • Size / Price
    Каталог: HG10449-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».