Быстрый заказ

Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ARPC5 Информация о продукте «Клон cDNA»
Размер кДНК:456bp
Описание кДНК:Full length Clone DNA of Homo sapiens actin related protein 2>3 complex, subunit 5, 16kDa with N terminal His tag.
Синоним гена:ARC16, p16-Arc, dJ127C7.3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16494-ACGRBS15400
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16494-ACRRBS15400
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16494-CFRBS13340
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16494-CHRBS13340
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16494-CMRBS13340
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16494-CYRBS13340
Человек p16 ARC/ARPC5 Джин клон кДНК в вектор клонированияHG16494-GRBS5130
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16494-NFRBS13340
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16494-NHRBS13340
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16494-NMRBS13340
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16494-NYRBS13340
Человек p16 ARC/ARPC5 Джин ORF экспрессии кДНК клона плазмидыHG16494-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16494-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.