Быстрый заказ

Text Size:AAA

Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ARPC1A Информация о продукте «Клон cDNA»
Размер кДНК:1113bp
Описание кДНК:Full length Clone DNA of Homo sapiens actin related protein 2/3 complex, subunit 1A, 41kDa with C terminal His tag.
Синоним гена:Arc40, SOP2L, SOP2Hs
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15172-ACGRBS15400
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15172-ACRRBS15400
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15172-ANGRBS15400
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15172-ANRRBS15400
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15172-CFRBS13340
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15172-CHRBS13340
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15172-CMRBS13340
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15172-CYRBS13340
Человек ARPC1A Джин клон кДНК в вектор клонированияHG15172-GRBS5130
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15172-NFRBS13340
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15172-NHRBS13340
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15172-NMRBS13340
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15172-NYRBS13340
Человек ARPC1A Джин ORF экспрессии кДНК клона плазмидыHG15172-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15172-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.