Быстрый заказ

Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AREG Информация о продукте «Клон cDNA»
Размер кДНК:2073 bp
Описание кДНК:Full length Clone DNA of Homo sapiens amphiregulin with N terminal Flag tag.
Участок рестрикции:KpnI + NotI(6kb+2.07kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10558-ACGRBS15400
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10558-ACRRBS15400
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10558-CFRBS13340
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10558-CHRBS13340
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10558-CMRBS13340
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10558-CYRBS13340
Человек Amphiregulin / AREG Джин клон кДНК в вектор клонированияHG10558-MRBS5130
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10558-M-FRBS13340
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10558-NFRBS14710
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10558-NHRBS13340
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10558-NMRBS13340
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10558-NYRBS13340
Человек Amphiregulin / AREG Джин ORF экспрессии кДНК клона плазмидыHG10558-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Amphiregulin(AREG), also known as colorectum cell-derived growth factor, CRDGF, SDGF and AREG, is a member of the epidermal growth factor family and the amphiregulin family. Members of EGF family are cytokines that include 10 proteins such as EGF, TGFb, HBEGF, and the various heregulins. Amphiregulin is a single-pass membrane protein and contains one EGF-like domain. It plays a key role in epithelial development in various organs. Amphiregulin has a realationship with epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells, and fibroblasts. As a bifunctional growth-modulating glycoprotein, amphiregulin inhibits growth of several human carcinoma cells in culture and stimulates proliferation of human fibroblasts and certain other tumor cells. Amphiregulin also may play a protective role in bleomycin-induced pneumopathy, probably through the activation of survival signals.

  • Shoyab M, et al. (1989) Structure and function of human amphiregulin: a member of the epidermal growth factor family. Science. 243 (4894): 1074-6.
  • Plowman GD, et al. (1990) The amphiregulin gene encodes a novel epidermal growth factor-related protein with tumor-inhibitory activity. Mol Cell Biol. 10 (5): 1969-81.
  • Culouscou JM, et al. (1993) Colorectum cell-derived growth factor (CRDGF) is homologous to amphiregulin, a member of the epidermal growth factor family. Growth Factors. 7 (3): 195-205.
  • Size / Price
    Каталог: HG10558-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.