Быстрый заказ

Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human APTX Информация о продукте «Клон cDNA»
Размер кДНК:507bp
Описание кДНК:Full length Clone DNA of Homo sapiens aprataxin with C terminal His tag.
Синоним гена:AOA, AOA1, AXA1, EAOH, EOAHA, FHA-HIT, MGC1072, FLJ20157, APTX
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10454-ACGRBS15400
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10454-ACRRBS15400
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10454-ANGRBS15400
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10454-ANRRBS15400
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10454-CFRBS13340
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10454-CHRBS13340
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10454-CMRBS13340
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10454-CYRBS13340
Человек Aprataxin/APTX Джин клон кДНК в вектор клонированияHG10454-MRBS5130
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10454-M-FRBS13340
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10454-NFRBS13340
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10454-NHRBS13340
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10454-NMRBS13340
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10454-NYRBS13340
Человек Aprataxin/APTX Джин ORF экспрессии кДНК клона плазмидыHG10454-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10454-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.