Быстрый заказ

Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек APEX1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001641.3
    Размер кДНК:957bp
    Описание кДНК:Full length Clone DNA of Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1.
    Синоним гена:APE, APX, APE1, APEN, APEX, HAP1, REF1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with APEX1 qPCR primers for gene expression analysis, HP104930 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16161-ACGRBS15400
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16161-ACRRBS15400
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16161-ANGRBS15400
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16161-ANRRBS15400
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16161-CFRBS13340
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16161-CHRBS13340
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16161-CMRBS13340
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16161-CYRBS13340
    Человек APEX1/APE1/Ref-1 Джин клон кДНК в вектор клонированияHG16161-GRBS5130
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16161-NFRBS13340
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16161-NHRBS13340
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16161-NMRBS13340
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16161-NYRBS13340
    Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмидыHG16161-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

    Ссылки
  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    Каталог: HG16161-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».