After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human APEX1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001641.3
Размер кДНК:957bp
Описание кДНК:Full length Clone DNA of Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1.
Синоним гена:APE, APX, APE1, APEN, APEX, HAP1, REF1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16161-ACGRBS15400
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16161-ACRRBS15400
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16161-ANGRBS15400
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16161-ANRRBS15400
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16161-CFRBS13340
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16161-CHRBS13340
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16161-CMRBS13340
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16161-CYRBS13340
Человек APEX1/APE1/Ref-1 Джин клон кДНК в вектор клонированияHG16161-GRBS5130
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16161-NFRBS13340
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16161-NHRBS13340
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16161-NMRBS13340
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16161-NYRBS13340
Человек APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмидыHG16161-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

Ссылки
  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    Каталог: HG16161-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».