APCDD1 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

APCDD1 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1545 bp
Description
Full length Clone DNA of Human adenomatosis polyposis coli down-regulated 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

APCDD1 cDNA ORF Clone, Human, N-His tag: Alternative Names

B7323 cDNA ORF Clone, Human; DRAPC1 cDNA ORF Clone, Human; FP7019 cDNA ORF Clone, Human; HHS cDNA ORF Clone, Human; HTS cDNA ORF Clone, Human; HYPT1 cDNA ORF Clone, Human

APCDD1 Background Information

Osteosarcoma (OS) is the most common type of bone tumor in children and adults. The expression of APCDD1, a Wnt antagonist, was reduced in OS tissues and cells compared to adjacent normal tissue and osteoblast cells, respectively. Mechanistically, this was due to increased levels of methylation in the promoter region of the APCDD1 gene. Consistently, the DNA methyltransferase inhibitor 5-AZA-dC, reduced DNA methylation in the APCDD1 promoter, and restored APCDD1 expression in OS tissue and cells. Moreover, DNMT3a, but not DNMT1 or DNMT3b, was the major DNA methyltransferase that facilitated hyper-methylation of DNA in the APCDD1 promoter, thus reducing APCDD1 mRNA levels in OS tissues. Importantly, ectopic expression of APCDD1 suppressed activity of the Wnt/beta-Catenin signaling pathway in OS cells and inhibited their invasion and reversed their EMT-like properties, while depletion of APCDD1 promoted invasion and metastasis of osteosarcoma cells in vitro and in vivo. That APCDD1 modulates the gene expression of Wnt- and EK-related signaling molecules at the cap stage of tooth development, and is involved in tooth cusp patterning by modulating the epithelial rearrangement in the IEE. In hair follicle cells APCDD1 inhibits the canonical WNT/beta-Catenin pathway and its inactivation is associated with an autosomal dominant form of hair loss. APCDD1 sustains the expression and activation of beta-Catenin.
Full Name
adenomatosis polyposis coli down-regulated 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait