Быстрый заказ

Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human APBA2 Информация о продукте «Клон cDNA»
Размер кДНК:2250bp
Описание кДНК:Full length Clone DNA of Homo sapiens amyloid beta (A4) precursor protein-binding, family A, member 2 with N terminal HA tag.
Синоним гена:X11L, MINT2, LIN-10, HsT16821, MGC99508, D15S1518E, MGC:14091, APBA2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11164-ACGRBS16764
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11164-ACRRBS16764
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11164-ANGRBS16764
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11164-ANRRBS16764
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11164-CFRBS14711
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11164-CHRBS14711
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11164-CMRBS14711
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11164-CYRBS14711
Человек APBA2 Джин клон кДНК в вектор клонированияHG11164-MRBS5132
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11164-NFRBS14711
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11164-NHRBS14711
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11164-NMRBS14711
Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11164-NYRBS14711
Человек APBA2 Джин ORF экспрессии кДНК клона плазмидыHG11164-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11164-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.