Быстрый заказ

Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек APBA2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005503.3
    Размер кДНК:2250bp
    Описание кДНК:Full length Clone DNA of Homo sapiens amyloid beta (A4) precursor protein-binding, family A, member 2 with N terminal HA tag.
    Синоним гена:X11L, MINT2, LIN-10, HsT16821, MGC99508, D15S1518E, MGC:14091, APBA2
    Виды:Human
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with APBA2 qPCR primers for gene expression analysis, HP101071 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11164-ACGRBS16760
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11164-ACRRBS16760
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11164-ANGRBS16760
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11164-ANRRBS16760
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11164-CFRBS14710
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11164-CHRBS14710
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11164-CMRBS14710
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11164-CYRBS14710
    Человек APBA2 Джин клон кДНК в вектор клонированияHG11164-MRBS5130
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11164-NFRBS14710
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11164-NHRBS14710
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11164-NMRBS14710
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11164-NYRBS14710
    Человек APBA2 Джин ORF экспрессии кДНК клона плазмидыHG11164-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».