Быстрый заказ

Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human AP2M1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC004996.1
Размер кДНК:1308bp
Описание кДНК:Full length Clone DNA of Homo sapiens adaptor-related protein complex 2, mu 1 subunit.
Синоним гена:mu2, AP50, CLAPM1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-AP2M1
Участок рестрикции:HindIII + NotI (6.1kb + 1.31kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16144-ACGRBS15396
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16144-ACRRBS15396
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16144-CFRBS13343
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16144-CHRBS13343
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16144-CMRBS13343
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16144-CYRBS13343
Человек AP2M1 Джин клон кДНК в вектор клонированияHG16144-GRBS5132
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16144-NFRBS13343
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16144-NHRBS13343
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16144-NMRBS13343
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16144-NYRBS13343
Человек AP2M1 Джин ORF экспрессии кДНК клона плазмидыHG16144-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16144-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».