Быстрый заказ

Text Size:AAA

Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ANXA6 Информация о продукте «Клон cDNA»
Размер кДНК:2022 bp
Описание кДНК:Full length Clone DNA of Homo sapiens annexin A6
Синоним гена:ANX6,CBP68
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11161-ACGRBS16760
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11161-ACRRBS16760
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11161-ANGRBS16760
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11161-ANRRBS16760
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11161-CFRBS5130
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11161-CHRBS14710
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11161-CMRBS14710
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11161-CYRBS14710
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11161-M-FRBS14710
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11161-NFRBS14710
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11161-NHRBS14710
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11161-NMRBS14710
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11161-NYRBS14710
Человек Annexin VI/ANXA6 Джин клон кДНК в вектор клонированияHG11161-URBS5130
Человек Annexin VI/ANXA6 Джин ORF экспрессии кДНК клона плазмидыHG11161-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Size / Price
    Каталог: HG11161-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.