Быстрый заказ

Text Size:AAA

Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ANXA5 Информация о продукте «Клон cDNA»
Размер кДНК:963bp
Описание кДНК:Full length Clone DNA of Homo sapiens annexin A5 with C terminal His tag.
Синоним гена:PP4, ANX5, ENX2, ANXA5
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10448-ACGRBS15400
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10448-ACRRBS15400
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10448-ANGRBS15400
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10448-ANRRBS15400
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10448-CFRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10448-CHRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10448-CMRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10448-CYRBS13340
Человек ANXA5 Джин клон кДНК в вектор клонированияHG10448-MRBS5130
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10448-M-FRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмидыHG10448-M-NRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10448-NFRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10448-NHRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10448-NMRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10448-NYRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмидыHG10448-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    Каталог: HG10448-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.