After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ANXA5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001154.3
Размер кДНК:963bp
Описание кДНК:Full length Clone DNA of Homo sapiens annexin A5 with C terminal His tag.
Синоним гена:PP4, ANX5, ENX2, ANXA5
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10448-ACGRBS15400
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10448-ACRRBS15400
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10448-ANGRBS15400
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10448-ANRRBS15400
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10448-CFRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10448-CHRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10448-CMRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10448-CYRBS13340
Человек ANXA5 Джин клон кДНК в вектор клонированияHG10448-MRBS5130
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10448-M-FRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмидыHG10448-M-NRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10448-NFRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10448-NHRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10448-NMRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10448-NYRBS13340
Человек ANXA5 Джин ORF экспрессии кДНК клона плазмидыHG10448-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    Каталог: HG10448-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».