ANXA13/Annexin A13 cDNA ORF Clone, Human, N-His tag

Cat: HG15832-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ANXA13/Annexin A13 Reagents

CRO Services

Product recommended


All ANXA13/Annexin A13 Reagents

ANXA13/Annexin A13 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Human annexin A13 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANXA13/Annexin A13 cDNA ORF Clone, Human, N-His tag Alternative Names

ANX13 cDNA ORF Clone, Human;ISA cDNA ORF Clone, Human

ANXA13/Annexin A13 Background Information

Full Name
annexin A13

ANXA13/Annexin A13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANXA13/Annexin A13 cDNA ORF Clone in Cloning Vector, Mouse MG5A5329-U
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, untagged MG5A5329-UT
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5329-ACG
ANXA13/Annexin A13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5329-ACGLN
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5329-ANG
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5329-ACR
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5329-ANR
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5329-CF
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5329-NF
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, C-His tag MG5A5329-CH
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, N-His tag MG5A5329-NH
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, C-HA tag MG5A5329-CY
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, N-HA tag MG5A5329-NY
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, C-Myc tag MG5A5329-CM
ANXA13/Annexin A13 cDNA ORF Clone, Mouse, N-Myc tag MG5A5329-NM

ANXA13/Annexin A13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANXA13/Annexin A13 cDNA ORF Clone in Cloning Vector, Human HG15832-G
ANXA13/Annexin A13 cDNA ORF Clone, Human, untagged HG15832-UT
ANXA13/Annexin A13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15832-ACGLN
ANXA13/Annexin A13 cDNA ORF Clone, Human, C-GFPSpark® tag HG15832-ACG
ANXA13/Annexin A13 cDNA ORF Clone, Human, C-OFPSpark® tag HG15832-ACR
ANXA13/Annexin A13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15832-CF
ANXA13/Annexin A13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15832-NF
ANXA13/Annexin A13 cDNA ORF Clone, Human, C-His tag HG15832-CH
ANXA13/Annexin A13 cDNA ORF Clone, Human, C-HA tag HG15832-CY
ANXA13/Annexin A13 cDNA ORF Clone, Human, N-HA tag HG15832-NY
ANXA13/Annexin A13 cDNA ORF Clone, Human, C-Myc tag HG15832-CM
ANXA13/Annexin A13 cDNA ORF Clone, Human, N-Myc tag HG15832-NM
ANXA13/Annexin A13 qPCR Primer Pairs, Human HP104423
info info
添加购物车成功! 添加购物车失败!