Быстрый заказ

Text Size:AAA

Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ANTXR1 Информация о продукте «Клон cDNA»
Размер кДНК:1002bp
Описание кДНК:Full length Clone DNA of Homo sapiens anthrax toxin receptor 1 with N terminal Flag tag.
Синоним гена:ATR, TEM8, ANTXR1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13367-ACGRBS15400
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13367-ACRRBS15400
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13367-CFRBS13340
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13367-CHRBS13340
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13367-CMRBS13340
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13367-CYRBS13340
Человек ANTXR1 Джин клон кДНК в вектор клонированияHG13367-GRBS5130
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13367-NFRBS13340
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13367-NHRBS13340
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13367-NMRBS13340
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13367-NYRBS13340
Человек ANTXR1 Джин ORF экспрессии кДНК клона плазмидыHG13367-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

ANTXR1 contains 1 VWFA domain and belongs to the ATR family. ATR (Ataxia telangiectasia and Rad3 related) and ATM (Ataxia telangiectasia mutated) are closely related kinases that are activated by DNA damage. They are serine-threonine protein kinases and belongs to the phosphatidylinositol 3' kinase-like kinase (PIKK) family. Upon recruitment by the DNA damage binding proteins/complexes (ATRIP for ATR; MRN for ATM), ATM/ATR initiate the DNA damage checkpoint by phosphorylating a number of key proteins. ANTXR1 interacts with extracellular matrix proteins and with the actin cytoskeleton. It functions in cell attachment and migration. ANTXR1 also mediates adhesion of cells to type 1 collagen and gelatin, reorganization of the actin cytoskeleton and promotes cell spreading. It plays a role in the angiogenic response of cultured umbilical vein endothelial cells.

  • Chaudhary A, et al. (2012) TEM8/ANTXR1 blockade inhibits pathological angiogenesis and potentiates tumoricidal responses against multiple cancer types. Cancer Cell. 21 (2): 212-26.
  • Garlick KM, et al. (2012) Binding of filamentous actin to anthrax toxin receptor 1 decreases its association with protective antigen. Biochemistry. 51 (6): 1249-56.
  • St Croix B, et al. (2000) Genes expressed in human tumor endothelium. Science. 289 (5482): 1197-202.
  • Size / Price
    Каталог: HG13367-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.