Быстрый заказ

Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ANKRD10 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC001727
    Размер кДНК:663bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ankyrin repeat domain 10.
    Синоним гена:RP11-120J20.3, DKFZp686B07190, FLJ20093, ANKRD10
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ANKRD10 qPCR primers for gene expression analysis, HP102916 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14266-ACGRBS15400
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14266-ACRRBS15400
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14266-ANGRBS15400
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14266-ANRRBS15400
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14266-CFRBS13340
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14266-CHRBS13340
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14266-CMRBS13340
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14266-CYRBS13340
    Человек ANKRD10 Джин клон кДНК в вектор клонированияHG14266-GRBS5130
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14266-NFRBS13340
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14266-NHRBS13340
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14266-NMRBS13340
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14266-NYRBS13340
    Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмидыHG14266-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14266-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».