After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ANKRD10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001727
Размер кДНК:663bp
Описание кДНК:Full length Clone DNA of Homo sapiens ankyrin repeat domain 10.
Синоним гена:RP11-120J20.3, DKFZp686B07190, FLJ20093, ANKRD10
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14266-ACGRBS15400
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14266-ACRRBS15400
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14266-ANGRBS15400
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14266-ANRRBS15400
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14266-CFRBS13340
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14266-CHRBS13340
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14266-CMRBS13340
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14266-CYRBS13340
Человек ANKRD10 Джин клон кДНК в вектор клонированияHG14266-GRBS5130
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14266-NFRBS13340
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14266-NHRBS13340
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14266-NMRBS13340
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14266-NYRBS13340
Человек ANKRD10 Джин ORF экспрессии кДНК клона плазмидыHG14266-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14266-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».