Быстрый заказ

Text Size:AAA

Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ANKH Информация о продукте «Клон cDNA»
Размер кДНК:1479bp
Описание кДНК:Full length Clone DNA of Homo sapiens ankylosis, progressive homolog (mouse) with C terminal HA tag.
Синоним гена:ANK, CMDJ, HANK, MANK, CCAL2, CPPDD, FLJ27166, ANKH
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10496-ACGRBS15400
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10496-ACRRBS15400
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10496-CFRBS13340
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10496-CHRBS13340
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10496-CMRBS13340
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10496-CYRBS13340
Человек ANK/ANKH Джин клон кДНК в вектор клонированияHG10496-MRBS5130
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10496-M-FRBS13340
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10496-NFRBS13340
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10496-NHRBS13340
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10496-NMRBS13340
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10496-NYRBS13340
Человек ANK/ANKH Джин ORF экспрессии кДНК клона плазмидыHG10496-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10496-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.