Angiopoietin-1 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

Angiopoietin-1 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1497 bp
Description
Full length Clone DNA of Human angiopoietin 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Angiopoietin-1 cDNA ORF Clone, Human, N-His tag: Alternative Names

AGP1 cDNA ORF Clone, Human; AGPT cDNA ORF Clone, Human; ANG1 cDNA ORF Clone, Human

Angiopoietin-1 Background Information

The angiopoietin (ANGPT)-TIE2/TEK signaling pathway is essential for blood and lymphatic vascular homeostasis. ANGPT1 is a potent TIE2 activator, whereas ANGPT2 functions as a context-dependent agonist/antagonist. In disease, ANGPT2-mediated inhibition of TIE2 in blood vessels is linked to vascular leak, inflammation, and metastasis. Primary congenital glaucoma (PCG) is a leading cause of blindness in children worldwide and is caused by developmental defects in 2 aqueous humor outflow structures, Schlemm's canal (SC) and the trabecular meshwork. We previously identified loss-of-function mutations in the angiopoietin (ANGPT) receptor TEK in families with PCG and showed that ANGPT/TEK signaling is essential for SC development. A role for the major ANGPT ligands in the development of the aqueous outflow pathway. We determined that ANGPT1 is essential for SC development, and that Angpt1-knockout mice form a severely hypomorphic canal with elevated intraocular pressure. By linking ANGPT1 with PCG, these results highlight the importance of ANGPT/TEK signaling in glaucoma pathogenesis and identify a candidate target for therapeutic development.
Full Name
angiopoietin 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait