Быстрый заказ

Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек ANGPT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001146.3
Размер кДНК:1497bp
Описание кДНК:Full length Clone DNA of Homo sapiens angiopoietin 1 with N terminal His tag.
Синоним гена:AGP1, AGPT, ANG1
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ANGPT1 qPCR primers for gene expression analysis, HP102347 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13667-ACGRBS15400
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13667-ACRRBS15400
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13667-CFRBS13340
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13667-CHRBS13340
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13667-CMRBS13340
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13667-CYRBS13340
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин клон кДНК в вектор клонированияHG13667-GRBS5130
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13667-NFRBS13340
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13667-NHRBS13340
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13667-NMRBS13340
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13667-NYRBS13340
Человек Angiopoietin 1 / ANG1 / ANGPT1 Джин ORF экспрессии кДНК клона плазмидыHG13667-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13667-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».