Быстрый заказ

Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ANAPC5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_016237.4
    Размер кДНК:2268bp
    Описание кДНК:Full length Clone DNA of Homo sapiens anaphase promoting complex subunit 5.
    Синоним гена:APC5
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ANAPC5 qPCR primers for gene expression analysis, HP102872 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14222-ACGRBS16760
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14222-ACRRBS16760
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14222-ANGRBS16760
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14222-ANRRBS16760
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14222-CFRBS14710
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14222-CHRBS14710
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14222-CMRBS14710
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14222-CYRBS14710
    Человек Apc5/ANAPC5 Джин клон кДНК в вектор клонированияHG14222-GRBS5130
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14222-NFRBS14710
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14222-NHRBS14710
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14222-NMRBS14710
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14222-NYRBS14710
    Человек Apc5/ANAPC5 Джин клон кДНК в вектор клонированияHG14222-URBS5130
    Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмидыHG14222-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14222-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».