After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ANAPC5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016237.4
Размер кДНК:2268bp
Описание кДНК:Full length Clone DNA of Homo sapiens anaphase promoting complex subunit 5.
Синоним гена:APC5
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14222-ACGRBS16764
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14222-ACRRBS16764
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14222-ANGRBS16764
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14222-ANRRBS16764
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14222-CFRBS14711
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14222-CHRBS14711
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14222-CMRBS14711
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14222-CYRBS14711
Человек Apc5/ANAPC5 Джин клон кДНК в вектор клонированияHG14222-GRBS5132
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14222-NFRBS14711
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14222-NHRBS14711
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14222-NMRBS14711
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14222-NYRBS14711
Человек Apc5/ANAPC5 Джин клон кДНК в вектор клонированияHG14222-URBS5132
Человек Apc5/ANAPC5 Джин ORF экспрессии кДНК клона плазмидыHG14222-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14222-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».