Быстрый заказ

Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек AMIGO2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC047595
    Размер кДНК:1569bp
    Описание кДНК:Full length Clone DNA of Homo sapiens adhesion molecule with Ig-like domain 2 with N terminal Myc tag.
    Синоним гена:ALI1, DEGA, AMIGO2
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AMIGO2 qPCR primers for gene expression analysis, HP102412 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13735-ACGRBS16760
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13735-ACRRBS16760
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13735-CFRBS14710
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13735-CHRBS14710
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13735-CMRBS14710
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13735-CYRBS14710
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин клон кДНК в вектор клонированияHG13735-GRBS5130
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13735-NFRBS14710
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13735-NHRBS14710
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13735-NMRBS14710
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13735-NYRBS14710
    Человек AMIGO2 / AMIGO-2 / alivin 1 Джин ORF экспрессии кДНК клона плазмидыHG13735-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It belongs to the immunoglobulin superfamily, AMIGO family. AMIGO2 may mediate homophilic as well as heterophilic cell-cell interaction with AMIGO1 or AMIGO3. It is required for depolarization-dependent survival of cultured cerebellar granule neurons. AMIGO2 may also contribute to signal transduction through its intracellular domain. It may play a role in the tumorigenesis of a subset of gastric adenocarcinomas. AMIGO2 is highly expressed in breast, ovary, cervix, and uterus.

    Ссылки
  • Rouhiainen A, et al. (2003) AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats. J Cell Biol. 160:963-73.
  • Kikkawa Y, et al. (2003) Alivin 1, a novel neuronal activity-dependent gene, inhibits apoptosis and promotes survival of cerebellar granule neurons. J Neurosci. 23:5887-96.
  • Bassi R, et al. (2004) DEGA/AMIGO-2, a leucine-rich repeat family member, differentially expressed in human gastric adenocarcinoma: effects on ploidy, chromosomal stability, cell adhesion/migration and tumorigenicity. Oncogene 23:5056-67.
  • Size / Price
    Каталог: HG13735-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».