Быстрый заказ

Text Size:AAA

Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BMPR1B Информация о продукте «Клон cDNA»
Размер кДНК:1509bp
Описание кДНК:Full length Clone DNA of Homo sapiens bone morphogenetic protein receptor, type I B with C terminal His tag.
Синоним гена:ALK6, ALK-6, CDw293, BMPR1B
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10460-ACGRBS16760
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10460-ACRRBS16760
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10460-CFRBS14710
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10460-CHRBS14710
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10460-CMRBS14710
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10460-CYRBS14710
Человек ALK-6 / BMPR1B Джин клон кДНК в вектор клонированияHG10460-MRBS5130
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10460-M-FRBS14710
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10460-NFRBS14710
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10460-NHRBS14710
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10460-NMRBS14710
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10460-NYRBS14710
Человек ALK-6 / BMPR1B Джин ORF экспрессии кДНК клона плазмидыHG10460-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

BMPR1B(bone morphogenetic protein receptor, type IB), also known as ALK6, is a a member of the bone morphogenetic protein (BMP) receptor family. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. BMPR1B is the major transducer of signals in precartilaginous condensations as demonstrated in experiments using constitutively active BMPR1B receptors. BMPR1B is a more effective trasducer of GDF5 than BMPR1A. Unlike BMPR1A null mice, which die at an early embryonic stage, BMPR1B null mice are viable.

  • Ide H, et al. (1998) Assignment of the BMPR1A and BMPR1B genes to human chromosome 10q22.3 and 4q23--q24 byin situ hybridization and radiation hybrid map ping. Cytogenet. Cell Genet. 81(3-4): 285-6.
  • Mishina Y, et al. (2004) Bone morphogenetic protein type IA receptor signaling regulates postnatal osteoblast function and bone remodeling. J Biol Chem. 279(26): 27560-6.
  • Yoon BS, et al. (2005) Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci. 102(14): 5062-7.
  • Size / Price
    Каталог: HG10460-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.