After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACVR1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004302.3
Размер кДНК:1518bp
Описание кДНК:Full length Clone DNA of Homo sapiens activin A receptor, type I B, transcript variant 1 with C terminal Myc tag.
Синоним гена:ALK4, SKR2, ACTRIB, ACVRLK4
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10583-ACGRBS16760
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10583-ACRRBS16760
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10583-CFRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10583-CHRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10583-CMRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10583-CYRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин клон кДНК в вектор клонированияHG10583-MRBS5130
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10583-M-FRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10583-M-NRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10583-NFRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10583-NHRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10583-NMRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10583-NYRBS14710
Человек ALK-4 / ACVR1B transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10583-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

Ссылки
  • Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.
  • J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».