After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BMPR1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004329.2
Размер кДНК:1599bp
Описание кДНК:Full length Clone DNA of Homo sapiens bone morphogenetic protein receptor, type I A with C terminal His tag.
Синоним гена:ALK3, CD292, ACVRLK3, 10q23del, BMPR1A
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10446-ACGRBS16760
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10446-ACRRBS16760
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10446-CFRBS14710
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10446-CHRBS14710
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10446-CMRBS14710
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10446-CYRBS14710
Человек ALK-3 / BMPR1A Джин клон кДНК в вектор клонированияHG10446-MRBS5130
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10446-M-FRBS14710
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10446-NFRBS14710
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10446-NHRBS14710
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10446-NMRBS14710
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10446-NYRBS14710
Человек ALK-3 / BMPR1A Джин ORF экспрессии кДНК клона плазмидыHG10446-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a type I receptor for bone morphogenetic proteins (BMPs) which belong to the transforming growth factor beta (TGF-β) superfamily. The BMP receptors form a subfamily of transmembrane serine/threonine kinases including the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. ALK-3/BMPR1A is expressed in the epithelium during branching morphogenesis. Deletion of BMPR1A in the epithelium with an Sftpc-cre transgene leads to dramatic defects in lung development. ALK-3 and ALK-6 share a high degree of homology, yet possess distinct signaling roles. The transforming growth factor (TGF)-beta type III receptor (TbetaRIII) enhanced both ALK-3 and ALK-6 signaling. TbetaRIII associated with ALK-3 primarily through their extracellular domains, whereas its interaction with ALK-6 required both the extracellular and cytoplasmic domains. ALK-3 plays an essential role in the formation of embryonic ventral abdominal wall, and abrogation of BMP signaling activity due to gene mutations in its signaling components could be one of the underlying causes of omphalocele at birth. The type IA BMP receptor, ALK-3 was specifically required at mid-gestation for normal development of the trabeculae, compact myocardium, interventricular septum, and endocardial cushion. Cardiac muscle lacking ALK-3 was specifically deficient in expressing TGFbeta2, an established paracrine mediator of cushion morphogenesis. Hence, ALK-3 is essential, beyond just the egg cylinder stage, for myocyte-dependent functions and signals in cardiac organogenesis.

Ссылки
  • Gaussin V, et al. (2002) Endocardial cushion and myocardial defects after cardiac myocyte-specific conditional deletion of the bone morphogenetic protein receptor ALK3. Proc Natl Acad Sci U S A. 99(5): 2878-83.
  • Eblaghie MC, et al. (2006) Evidence that autocrine signaling through Bmpr1a regulates the proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev Biol. 291(1): 67-82.
  • Sun J, et al. (2007) Deficient Alk3-mediated BMP signaling causes prenatal omphalocele-like defect. Biochem Biophys Res Commun. 360(1): 238-43.
  • Lee NY, et al. (2009) The transforming growth factor-beta type III receptor mediates distinct subcellular trafficking and downstream signaling of activin-like kinase (ALK)3 and ALK6 receptors. Mol Biol Cell. 20(20): 4362-70.
  • Size / Price
    Каталог: HG10446-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».