Быстрый заказ

Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ALDH2 Информация о продукте «Клон cDNA»
Размер кДНК:1554bp
Описание кДНК:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 2 family (mitochondrial) with N terminal Flag tag.
Синоним гена:ALDH2
Участок рестрикции:KpnI + XbaI (6kb + 1.59kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ALDH2 Gene Plasmid Map
Human ALDH2 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12064-ACGRBS16760
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12064-ACRRBS16760
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12064-ANGRBS16760
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12064-ANRRBS16760
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12064-CFRBS14710
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12064-CHRBS14710
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12064-CMRBS14710
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12064-CYRBS14710
Человек ALDH2 Джин клон кДНК в вектор клонированияHG12064-GRBS5130
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмидыHG12064-G-NRBS14710
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12064-NFRBS14710
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12064-NHRBS14710
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12064-NMRBS14710
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12064-NYRBS14710
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмидыHG12064-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12064-NF
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human ALDH2 natural ORF mammalian expression plasmid, N-Flag tag
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.