After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ALDH2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000690
Размер кДНК:1554bp
Описание кДНК:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 2 family (mitochondrial) with C terminal HA tag.
Синоним гена:ALDH2
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12064-ACGRBS16764
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12064-ACRRBS16764
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12064-ANGRBS16764
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12064-ANRRBS16764
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12064-CFRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12064-CHRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12064-CMRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12064-CMRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12064-CYRBS14711
Человек ALDH2 Джин клон кДНК в вектор клонированияHG12064-GRBS5132
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмидыHG12064-G-NRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмидыHG12064-G-NRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12064-NFRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12064-NHRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12064-NMRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12064-NYRBS14711
Человек ALDH2 Джин ORF экспрессии кДНК клона плазмидыHG12064-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12064-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».