Быстрый заказ

Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ALDH2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_000690
    Размер кДНК:1554bp
    Описание кДНК:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 2 family (mitochondrial) with C terminal HA tag.
    Синоним гена:ALDH2
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ALDH2 qPCR primers for gene expression analysis, HP101595 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12064-ACGRBS16760
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12064-ACRRBS16760
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12064-ANGRBS16760
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12064-ANRRBS16760
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12064-CFRBS14710
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12064-CHRBS14710
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12064-CMRBS14710
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12064-CYRBS14710
    Человек ALDH2 Джин клон кДНК в вектор клонированияHG12064-GRBS5130
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмидыHG12064-G-NRBS14710
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12064-NFRBS14710
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12064-NHRBS14710
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12064-NMRBS14710
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12064-NYRBS14710
    Человек ALDH2 Джин ORF экспрессии кДНК клона плазмидыHG12064-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG12064-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».