After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ALDH1B1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001619
Размер кДНК:1554bp
Описание кДНК:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 1 family, member B1 with C terminal HA tag.
Синоним гена:ALDH5, ALDHX, ALDH1B1
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13439-ACGRBS16760
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13439-ACRRBS16760
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13439-ANGRBS16760
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13439-ANRRBS16760
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13439-CFRBS14710
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13439-CHRBS14710
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13439-CMRBS14710
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13439-CYRBS14710
Человек ALDH1B1 Джин клон кДНК в вектор клонированияHG13439-GRBS5130
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13439-NFRBS14710
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13439-NHRBS14710
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13439-NMRBS14710
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13439-NYRBS14710
Человек ALDH1B1 Джин ORF экспрессии кДНК клона плазмидыHG13439-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13439-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».