Быстрый заказ

Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ALDH1A3 Информация о продукте «Клон cDNA»
Размер кДНК:1539bp
Описание кДНК:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 1 family, member A3 with C terminal Flag tag.
Синоним гена:ALDH6, RALDH3, ALDH1A6, ALDH1A3
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1530 G/A and 1536 C/A not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11636-ACGRBS16760
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11636-ACRRBS16760
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11636-ANGRBS16760
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11636-ANRRBS16760
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11636-CFRBS14710
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11636-CHRBS14710
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11636-CMRBS14710
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11636-CYRBS14710
Человек ALDH1A3/RALDH3 Джин клон кДНК в вектор клонированияHG11636-MRBS5130
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11636-NFRBS14710
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11636-NHRBS14710
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11636-NMRBS14710
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11636-NYRBS14710
Человек ALDH1A3/RALDH3 Джин ORF экспрессии кДНК клона плазмидыHG11636-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Aldehyde dehydrogenase 1 family, member A3 (ALDH1A3), also known as Retinaldehyde dehydrogenase 3 (RALDH3), which belongs to the aldehyde dehydrogenase family. ALDH1A3 is a novel Cancer stem cell (CSC) marker with potential clinical prognostic applicability, and demonstrates a clear correlation between CSC prevalence and the development of metastatic breast cancer. The retinoic acid (RA) biosynthesis enzyme aldehyde dehydrogenase 1A3 (ALDH1A3) is a putative androgen-responsive gene in human prostate cancer epithelial (LNCaP) cells. The RA biosynthesis enzyme ALDH1A3 is androgen responsive and (ii) DHT up-regulation of ALDH1A3 can increase the oxidation of retinal to RA and indirectly affect RA bioactivity and metabolism.

  • Marcato P, et al. (2011) Aldehyde dehydrogenase activity of breast cancer stem cells is primarily due to isoform ALDH1A3 and its expression is predictive of metastasis. Stem Cells. 29(1)32-45.
  • Trasino SE, et al. (2007) Androgen regulation of aldehyde dehydrogenase 1A3 (ALDH1A3) in the androgen-responsive human prostate cancer cell line LNCaP. Exp Biol Med (Maywood). 232(6): 762-71.
  • Size / Price
    Каталог: HG11636-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human AURKB ORF mammalian expression plasmid, C-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.