After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AKT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001014431.1
Размер кДНК:1443bp
Описание кДНК:Full length Clone DNA of Homo sapiens v-akt murine thymoma viral oncogene homolog 1 with N terminal His tag.
Синоним гена:AKT, PKB, RAC, PRKBA, MGC99656, PKB-ALPHA, RAC-ALPHA, AKT1
Виды:Human
переносчик:pCMV3-N-His
Plasmid:pCMV3-His-AKT1
Участок рестрикции:KpnI + XbaI (6kb + 1.49kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human AKT1 Gene Plasmid Map
Human AKT1 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10763-ACGRBS15400
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10763-ACRRBS15400
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10763-ANGRBS15400
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10763-ANRRBS15400
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10763-CFRBS13340
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10763-CHRBS13340
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10763-CMRBS13340
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10763-CYRBS13340
Человек AKT1 Джин клон кДНК в вектор клонированияHG10763-GRBS5130
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10763-NFRBS13340
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10763-NHRBS13340
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10763-NMRBS13340
Человек AKT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10763-NYRBS13340
Человек AKT1 Джин ORF экспрессии кДНК клона плазмидыHG10763-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

v-akt murine thymoma viral oncogene homolog 1 (AKT1), or protein kinase B-alpha (PKB-ALPHA) is a serine-threonine protein kinase, belonging to the Protein Kinase Superfamily. AKT1 is a major mediator of the responses to insulin, insulin-like growth factor 1 (IGF1), and glucose. AKT1 also plays a key role in the regulation of both muscle cell hypertrophy and atrophy. AKT1 activity is required for physiologic cardiac growth in response to IGF1 stimulation or exercise training. In contrast, AKT1 activity was found to antagonize pathologic cardiac growth that occurs in response to endothelin 1 stimulation or pressure overload. AKT1 selectively promotes physiological cardiac growth while AKT2 selectively promotes insulin-stimulated cardiac glucose metabolism. AKT1 deletion prevented tumor initiation as well as tumor progression, coincident with decreased Akt signaling in tumor tissues. AKT1 is the primary Akt isoform activated by mutant K-ras in lung tumors, and that AKT3 may oppose AKT1 in lung tumorigenesis and lung tumor progression. A number of separate studies have implicated AKT1 as an inhibitor of breast epithelial cell motility and invasion. AKT1 may have a dual role in tumorigenesis, acting not only pro-oncogenically by suppressing apoptosis but also anti-oncogenically by suppressing invasion and metastasis.

Ссылки
  • Hollander MC, et al. (2011) Akt1 deletion prevents lung tumorigenesis by mutant K-ras. Oncogene. 30(15): 1812-21.
  • Devaney JM, et al. (2011) AKT1 polymorphisms are associated with risk for metabolic syndrome. Hum Genet. 129(2): 129-39.
  • Dillon RL, et al. (2010) Distinct biological roles for the akt family in mammary tumor progression. Cancer Res. 70(11): 4260-4.
  • Toker A, et al. (2006) Akt signaling and cancer: surviving but not moving on. Cancer Res. 66(8): 3963-6.
  • Muslin AJ, et al. (2006) Role of Akt in cardiac growth and metabolism. Novartis Found Symp. 274: 118-26.
  • Size / Price
    Каталог: HG10763-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human AKT1 natural ORF mammalian expression plasmid, N-His tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».