Быстрый заказ

Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AK4 Информация о продукте «Клон cDNA»
Размер кДНК:672bp
Описание кДНК:Full length Clone DNA of Homo sapiens adenylate kinase 4 with N terminal His tag.
Синоним гена:AK3, AK3L1, AK3L2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12406-ACGRBS15400
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12406-ACRRBS15400
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12406-ANGRBS15400
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12406-ANRRBS15400
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12406-CFRBS13340
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12406-CHRBS13340
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12406-CMRBS13340
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12406-CYRBS13340
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин клон кДНК в вектор клонированияHG12406-GRBS5130
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12406-NFRBS13340
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12406-NHRBS13340
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12406-NMRBS13340
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12406-NYRBS13340
Человек AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмидыHG12406-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Каталог: HG12406-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.