Быстрый заказ

Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AJAP1 Информация о продукте «Клон cDNA»
Размер кДНК:1236bp
Описание кДНК:Full length Clone DNA of Homo sapiens adherens junctions associated protein 1 with C terminal His tag.
Синоним гена:MOT8, SHREW1, SHREW-1, RP3-426F10.1, AJAP1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13392-ACGRBS15400
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13392-ACRRBS15400
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13392-CFRBS13340
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13392-CHRBS13340
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13392-CMRBS13340
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13392-CYRBS13340
Человек AJAP1 Джин клон кДНК в вектор клонированияHG13392-GRBS5130
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13392-NFRBS13340
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13392-NHRBS13340
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13392-NMRBS13340
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13392-NYRBS13340
Человек AJAP1 Джин ORF экспрессии кДНК клона плазмидыHG13392-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13392-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.