Быстрый заказ

Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек AIPL1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC012055
    Размер кДНК:1155bp
    Описание кДНК:Full length Clone DNA of Homo sapiens aryl hydrocarbon receptor interacting protein-like 1 with C terminal Myc tag.
    Синоним гена:LCA4, AIPL2
    Виды:Human
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AIPL1 qPCR primers for gene expression analysis, HP103385 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14752-ACGRBS15400
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14752-ACRRBS15400
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14752-ANGRBS15400
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14752-ANRRBS15400
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14752-CFRBS13340
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14752-CHRBS13340
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14752-CMRBS13340
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14752-CYRBS13340
    Человек AIPL1 Джин клон кДНК в вектор клонированияHG14752-GRBS5130
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14752-NFRBS13340
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14752-NHRBS13340
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14752-NMRBS13340
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14752-NYRBS13340
    Человек AIPL1 Джин ORF экспрессии кДНК клона плазмидыHG14752-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14752-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».