Быстрый заказ

Text Size:AAA

Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AIM2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004833.1
Размер кДНК:1032bp
Описание кДНК:Full length Clone DNA of Homo sapiens absent in melanoma 2 with C terminal Flag tag.
Синоним гена:PYHIN4, AIM2
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11654-ACGRBS15400
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11654-ACRRBS15400
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11654-ANGRBS15400
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11654-ANRRBS15400
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11654-CFRBS13340
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11654-CHRBS13340
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11654-CMRBS13340
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11654-CYRBS13340
Человек AIM2 Джин клон кДНК в вектор клонированияHG11654-MRBS5130
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11654-NFRBS13340
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11654-NHRBS13340
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11654-NMRBS13340
Человек AIM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11654-NYRBS13340
Человек AIM2 Джин ORF экспрессии кДНК клона плазмидыHG11654-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

AIM2, Absent In Melanoma 2 is a member of the interferon-inducible HIN-200 protein family that contains an amino-terminal pyrin domain and a carboxy-terminal oligonucleotide/oligosaccharide-binding domain, senses cytoplasmic DNA by means of its oligonucleotide/oligosaccharide-binding domain and interacts with ASC (apoptosis-associated speck-like protein containing a CARD) through its pyrin domain to activate caspase-1. In response to foreign cytoplasmic DNA, AIM2 forms an inflammasome, resulting in caspase activation in inflammatory cells. It had been pointed to a role of AIM2 function in both inflammation and cancer. AIM-2 antigen is expressed in a wide variety of tumor types, including neuroectodermal tumors, as well as breast, ovarian and colon carcinomas. AIM-2 could be used as a tumor antigen target for monitoring vaccine trials or to develop antigen specific active immunotherapy for glioma patients.

Ссылки
  • Patsos G, et al. (2010) Restoration of absent in melanoma 2 (AIM2) induces G2/M cell cycle arrest and promotes invasion of colorectal cancer cells. Int J Cancer. 126(8): 1838-49.
  • Fernandes-Alnemri T, et al. (2009) AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 458(7237): 509-13.
  • Chen IF, et al. (2006) AIM2 suppresses human breast cancer cell proliferation in vitro and mammary tumor growth in a mouse model. Mol Cancer Ther. 5(1): 1-7.
  • Liu G, et al. (2004) AIM-2: a novel tumor antigen is expressed and presented by human glioma cells. J Immunother. 27(3): 220-6.
  • Size / Price
    Каталог: HG11654-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».