After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human AIG1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC025278
Размер кДНК:717bp
Описание кДНК:Full length Clone DNA of Homo sapiens androgen-induced 1 DNA.
Синоним гена:AIG-1, dJ95L4.1, RP1-95L4.1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15241-ACGRBS15400
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15241-ACRRBS15400
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15241-CFRBS13340
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15241-CHRBS13340
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15241-CMRBS13340
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15241-CYRBS13340
Человек AIG1 Джин клон кДНК в вектор клонированияHG15241-GRBS5130
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15241-NFRBS13340
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15241-NHRBS13340
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15241-NMRBS13340
Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15241-NYRBS13340
Человек AIG1 Джин ORF экспрессии кДНК клона плазмидыHG15241-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15241-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».