Быстрый заказ

Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек AIG1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC025278
    Размер кДНК:717bp
    Описание кДНК:Full length Clone DNA of Homo sapiens androgen-induced 1 DNA.
    Синоним гена:AIG-1, dJ95L4.1, RP1-95L4.1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AIG1 qPCR primers for gene expression analysis, HP103867 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15241-ACGRBS15400
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15241-ACRRBS15400
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15241-CFRBS13340
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15241-CHRBS13340
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15241-CMRBS13340
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15241-CYRBS13340
    Человек AIG1 Джин клон кДНК в вектор клонированияHG15241-GRBS5130
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15241-NFRBS13340
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15241-NHRBS13340
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15241-NMRBS13340
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15241-NYRBS13340
    Человек AIG1 Джин ORF экспрессии кДНК клона плазмидыHG15241-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15241-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».