Быстрый заказ

Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human AIF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC009474
Размер кДНК:444bp
Описание кДНК:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1.
Синоним гена:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-AIF1
Участок рестрикции:KpnI + XbaI (6.1kb + 0.44kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human AIF1 Gene Plasmid Map
Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14227-ACGRBS15400
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14227-ACRRBS15400
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14227-ANGRBS15400
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14227-ANRRBS15400
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14227-CFRBS13340
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14227-CHRBS13340
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14227-CMRBS13340
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14227-CYRBS13340
Человек IBA1/AIF1 Джин клон кДНК в вектор клонированияHG14227-GRBS5130
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14227-NFRBS13340
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14227-NHRBS13340
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14227-NMRBS13340
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14227-NYRBS13340
Человек IBA1/AIF1 Джин ORF экспрессии кДНК клона плазмидыHG14227-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Каталог: HG14227-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».