Быстрый заказ

Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AHR Информация о продукте «Клон cDNA»
Размер кДНК:2547bp
Описание кДНК:Full length Clone DNA of Homo sapiens aryl hydrocarbon receptor with C terminal His tag.
Синоним гена:AHR
Участок рестрикции:KpnI + NotI (6kb + 2.59kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human AHR Gene Plasmid Map
Human AHR ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10456-ACGRBS22240
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10456-ACRRBS22240
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10456-ANGRBS22240
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10456-ANRRBS22240
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10456-CFRBS20190
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10456-CHRBS20190
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10456-CMRBS20190
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10456-CYRBS20190
Человек Aryl Hydrocarbon Receptor Джин клон кДНК в вектор клонированияHG10456-MRBS5130
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10456-NFRBS20190
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10456-NHRBS20190
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10456-NMRBS20190
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10456-NYRBS20190
Человек Aryl Hydrocarbon Receptor Джин ORF экспрессии кДНК клона плазмидыHG10456-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10456-CH
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.