After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human AHNAK2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC049216
Размер кДНК:1452bp
Описание кДНК:Full length Clone DNA of Homo sapiens AHNAK nucleoprotein 2 DNA.
Синоним гена:C14orf78
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15220-ACGRBS15400
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15220-ACRRBS15400
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15220-ANGRBS15400
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15220-ANRRBS15400
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15220-CFRBS13340
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15220-CHRBS13340
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15220-CMRBS13340
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15220-CYRBS13340
Человек AHNAK2/AHNAK nucleoprotein 2 Джин клон кДНК в вектор клонированияHG15220-GRBS5130
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15220-NFRBS13340
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15220-NHRBS13340
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15220-NMRBS13340
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15220-NYRBS13340
Человек AHNAK2/AHNAK nucleoprotein 2 Джин ORF экспрессии кДНК клона плазмидыHG15220-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15220-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».