AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-His tag

Cat: HG14250-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All AGPAT2/LPAAT-beta Reagents

CRO Services

Product recommended


All AGPAT2/LPAAT-beta Reagents

AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
840 bp
Description
Full length Clone DNA of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-His tag Alternative Names

1-AGPAT2 cDNA ORF Clone, Human;BSCL cDNA ORF Clone, Human;BSCL1 cDNA ORF Clone, Human;LPAAB cDNA ORF Clone, Human;LPAAT-beta cDNA ORF Clone, Human

AGPAT2/LPAAT-beta Background Information

Full Name
1-acylglycerol-3-phosphate O-acyltransferase 2

AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AGPAT2/LPAAT-beta cDNA ORF Clone in Cloning Vector, Rat RG80533-U
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, untagged RG80533-UT
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80533-ACG
AGPAT2/LPAAT-beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80533-ACGLN
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80533-ACR
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80533-CF
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80533-NF
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-His tag RG80533-CH
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, N-His tag RG80533-NH
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-HA tag RG80533-CY
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, N-HA tag RG80533-NY
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-Myc tag RG80533-CM
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, N-Myc tag RG80533-NM
AGPAT2/LPAAT-beta qPCR Primer Pairs, Rat RP300497

AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AGPAT2/LPAAT-beta cDNA ORF Clone in Cloning Vector, Mouse MG53399-U
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, untagged MG53399-UT
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53399-ACG
AGPAT2/LPAAT-beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53399-ACGLN
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53399-ACR
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53399-CF
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53399-NF
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-His tag MG53399-CH
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, N-His tag MG53399-NH
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-HA tag MG53399-CY
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, N-HA tag MG53399-NY
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-Myc tag MG53399-CM
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, N-Myc tag MG53399-NM

AGPAT2/LPAAT-beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AGPAT2/LPAAT-beta cDNA ORF Clone in Cloning Vector, Human HG14250-G
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, untagged HG14250-UT
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-GFPSpark® tag HG14250-ACG
AGPAT2/LPAAT-beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14250-ACGLN
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-OFPSpark® tag HG14250-ACR
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14250-CF
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14250-NF
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-His tag HG14250-CH
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-HA tag HG14250-CY
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-HA tag HG14250-NY
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-Myc tag HG14250-CM
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-Myc tag HG14250-NM
AGPAT2/LPAAT-beta qPCR Primer Pairs, Human HP102900
info info
添加购物车成功! 添加购物车失败!