After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human AGPAT2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC019292
Размер кДНК:840bp
Описание кДНК:Full length Clone DNA of Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta).
Синоним гена:1-AGPAT2, BSCL, BSCL1, LPAAB, LPAAT-beta, AGPAT2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14250-ACGRBS15400
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14250-ACRRBS15400
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14250-CFRBS13340
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14250-CHRBS13340
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14250-CMRBS13340
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14250-CYRBS13340
Человек AGPAT2/LPAAT-beta Джин клон кДНК в вектор клонированияHG14250-GRBS5130
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14250-NFRBS13340
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14250-NHRBS13340
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14250-NMRBS13340
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14250-NYRBS13340
Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмидыHG14250-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14250-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».