Быстрый заказ

Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек AGPAT2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC019292
    Размер кДНК:840bp
    Описание кДНК:Full length Clone DNA of Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) with N terminal His tag.
    Синоним гена:1-AGPAT2, BSCL, BSCL1, LPAAB, LPAAT-beta, AGPAT2
    Виды:Human
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AGPAT2 qPCR primers for gene expression analysis, HP102900 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14250-ACGRBS15400
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14250-ACRRBS15400
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14250-CFRBS13340
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14250-CHRBS13340
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14250-CMRBS13340
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14250-CYRBS13340
    Человек AGPAT2/LPAAT-beta Джин клон кДНК в вектор клонированияHG14250-GRBS5130
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14250-NFRBS13340
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14250-NHRBS13340
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14250-NMRBS13340
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14250-NYRBS13340
    Человек AGPAT2/LPAAT-beta Джин ORF экспрессии кДНК клона плазмидыHG14250-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14250-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».