Быстрый заказ

Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек AGPAT1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC002402
    Размер кДНК:852bp
    Описание кДНК:Full length Clone DNA of Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) with N terminal His tag.
    Синоним гена:DAAP-218M18.8, 1-AGPAT1, G15, LPAAT-alpha, LPAATA, MGC4007, MGC5423, AGPAT1
    Виды:Human
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AGPAT1 qPCR primers for gene expression analysis, HP102903 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14253-ACGRBS15400
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14253-ACRRBS15400
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14253-CFRBS13340
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14253-CHRBS13340
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14253-CMRBS13340
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14253-CYRBS13340
    Человек AGPAT1 Джин клон кДНК в вектор клонированияHG14253-GRBS5130
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14253-NFRBS13340
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14253-NHRBS13340
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14253-NMRBS13340
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14253-NYRBS13340
    Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмидыHG14253-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14253-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».