After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AGPAT1 Информация о продукте «Клон cDNA»
Размер кДНК:852bp
Описание кДНК:Full length Clone DNA of Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) with N terminal His tag.
Синоним гена:DAAP-218M18.8, 1-AGPAT1, G15, LPAAT-alpha, LPAATA, MGC4007, MGC5423, AGPAT1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14253-ACGRBS15400
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14253-ACRRBS15400
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14253-CFRBS13340
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14253-CHRBS13340
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14253-CMRBS13340
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14253-CYRBS13340
Человек AGPAT1 Джин клон кДНК в вектор клонированияHG14253-GRBS5130
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14253-NFRBS13340
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14253-NHRBS13340
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14253-NMRBS13340
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14253-NYRBS13340
Человек AGPAT1 Джин ORF экспрессии кДНК клона плазмидыHG14253-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.