Быстрый заказ

Text Size:AAA

Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AGO1 Информация о продукте «Клон cDNA»
Размер кДНК:2574bp
Описание кДНК:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2C, 1 with N terminal Flag tag.
Синоним гена:Q99, AGO1, EIF2C, GERP95, DKFZp686M13167, EIF2C1
Участок рестрикции:KpnI + XbaI (6kb + 2.61kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human AGO1 Gene Plasmid Map
Human AGO1 ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11225-ACGRBS22240
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11225-ACRRBS22240
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11225-ANGRBS22240
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11225-ANRRBS22240
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11225-CFRBS20190
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11225-CHRBS20190
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11225-CMRBS20190
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11225-CYRBS20190
Человек AGO1 / Argonaute 1 Джин клон кДНК в вектор клонированияHG11225-MRBS5130
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11225-M-FRBS20190
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11225-NFRBS20190
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11225-NHRBS20190
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11225-NMRBS20190
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11225-NYRBS20190
Человек AGO1 / Argonaute 1 Джин ORF экспрессии кДНК клона плазмидыHG11225-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Protein argonaute-1, also known as eukaryotic translation initiation factor 2C 1, EIF2C1, and AGO1, is a member of the argonaute family and ago subfamily. Protein argonaute-1 in humans is encoded by the EIF2C1 gene. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and argonaute 4. This genomic region is frequently lost in human cancers such as Wilms tumors, neuroblastoma, and carcinomas of the breast, liver, and colon. The human EIF2C1 gene is ubiquitously expressed at low to medium levels. Differential polyadenylation and splicing result in a complex transcriptional pattern. EIF2C1 protein contains one PAZ domain and one Piwi domain. It is required for RNA-mediated gene silencing (RNAi) and transcriptional gene silencing (TGS) of promoter regions which are complementary to bound short antigene RNAs (agRNAs). EIF2C1 binds to short RNAs such as microRNAs (miRNAs) or short interfering RNAs (siRNAs), and represses the translation of mRNAs which are complementary to them.

Size / Price
Каталог: HG11225-NF
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.