RAGE cDNA ORF Clone, Human, C-HA tag

Cat: HG11629-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RAGE Reagents

CRO Services

Product recommended


All RAGE Reagents

RAGE cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1215 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human advanced glycosylation end product-specific receptor, transcript variant 1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.26kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RAGE cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAGE cDNA ORF Clone, Human, C-HA tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5612

RAGE cDNA ORF Clone, Human, C-HA tag Alternative Names

RAGE cDNA ORF Clone, Human

RAGE Background Information

Receptor for Advanced Glycosylation End Products (RAGE, or AGER) is a member of the immunoglobulin super-family transmembrane proteins, as a signal transduction receptor which binds advanced glycation endproducts, certain members of the S100/calgranulin family of proteins, high mobility group box 1 (HMGB1), advanced oxidation protein products, and amyloid (beta-sheet fibrils). Initial studies investigating the role of RAGE in renal dysfunction focused on diabetes, neurodegenerative disorders, and inflammatory responses. However, RAGE also has roles in the pathogenesis of renal disorders that are not associated with diabetes, such as obesity-related glomerulopathy, doxorubicin-induced nephropathy, hypertensive nephropathy, lupus nephritis, renal amyloidosis, and ischemic renal injuries. RAGE represents an important factor in innate immunity against pathogens, but it also interacts with endogenous ligands, resulting in chronic inflammation. RAGE signaling has been implicated in multiple human illnesses, including atherosclerosis, arthritis, Alzheimer's disease, atherosclerosis and aging associated diseases.

Full Name
advanced glycosylation end product-specific receptor
References
  • Zhou Z, et al. (2011) RAGE and its ligands in bone metabolism. Front Biosci (Schol Ed). 3: 768-76.
  • Mosquera JA. (2010) Role of the receptor for advanced glycation end products (RAGE) in inflammation]. Invest Clin. 51(2): 257-68.
  • D'Agati V, et al. (2010) RAGE and the pathogenesis of chronic kidney disease. Nat Rev Nephrol. 6(6): 352-60.
  • RAGE cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RAGE cDNA ORF Clone in Cloning Vector, Mouse MG50489-M
    RAGE cDNA ORF Clone, Mouse, untagged MG50489-UT
    RAGE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50489-ACG
    RAGE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50489-ACGLN
    RAGE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50489-ACR
    RAGE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50489-CF
    RAGE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50489-NF
    RAGE cDNA ORF Clone, Mouse, C-His tag MG50489-CH
    RAGE cDNA ORF Clone, Mouse, N-His tag MG50489-NH
    RAGE cDNA ORF Clone, Mouse, N-HA tag MG50489-NY
    RAGE cDNA ORF Clone, Mouse, C-Myc tag MG50489-CM
    RAGE cDNA ORF Clone, Mouse, C-Myc tag MG50489-CY
    RAGE cDNA ORF Clone, Mouse, N-Myc tag MG50489-NM
    RAGE qPCR Primer Pairs, Mouse MP200483

    RAGE cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RAGE cDNA ORF Clone in Cloning Vector, Human HG11629-M
    RAGE cDNA ORF Clone, Human, untagged HG11629-UT
    RAGE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11629-ACGLN
    RAGE cDNA ORF Clone, Human, C-GFPSpark® tag HG11629-ACG
    RAGE cDNA ORF Clone, Human, C-OFPSpark® tag HG11629-ACR
    RAGE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11629-CF
    RAGE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11629-NF
    RAGE cDNA ORF Clone, Human, C-His tag HG11629-CH
    RAGE cDNA ORF Clone, Human, N-His tag HG11629-NH
    RAGE cDNA ORF Clone, Human, N-HA tag HG11629-NY
    RAGE cDNA ORF Clone, Human, C-Myc tag HG11629-CM
    RAGE cDNA ORF Clone, Human, N-Myc tag HG11629-NM
    RAGE qPCR Primer Pairs, Human HP101481
    info info
    添加购物车成功! 添加购物车失败!