After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AFP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC027881
Размер кДНК:1830bp
Описание кДНК:Full length Clone DNA of Homo sapiens alpha-fetoprotein with C terminal Myc tag.
Синоним гена:FETA, HPAFP, AFP
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12177-ACGRBS16760
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12177-ACRRBS16760
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12177-CFRBS14710
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12177-CHRBS14710
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12177-CMRBS14710
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12177-CYRBS14710
Человек Alpha-fetoprotein/AFP Джин клон кДНК в вектор клонированияHG12177-GRBS5130
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12177-NFRBS14710
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12177-NHRBS14710
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12177-NMRBS14710
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12177-NYRBS14710
Человек Alpha-fetoprotein/AFP Джин ORF экспрессии кДНК клона плазмидыHG12177-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin D (Gc) protein, and alpha-albumin. AFP is a glycoprotein of 591 amino acids and a carbohydrate moiety. AFP is one of the several embryo-specific proteins and is a dominant serum protein as early in human embryonic life as one month, when albumin and transferrin are present in relatively small amounts. It is first synthesized in the human by the yolk sac and liver(1-2 months) and subsequently predominantly in the liver. A small amount of AFP is produced by the GI tract of the human conceptus. It has been proved that AFP may reappear in the serum in elevated amounts in adult life in association with normal restorative processes and with malignant growth. Alpha-fetoprotein (AFP) is a specific marker for hepatocellular carcinoma (HCC), teratoblastomas, and neural tube defect (NTD).

Ссылки
  • Mizejewski GJ. (2001) Alpha-fetoprotein Structure and Function: Relevance to Isoforms, Epitopes, and Conformational Variants. Exp Biol Med. 226(5): 377-408.
  • Tomasi TB, et al. (1977) Structure and Function of Alpha-Fetoprotein. Annual Review of Medicine. 28: 453-65.
  • Leguy MC, et al. (2011) Assessment of AFP in amniotic fluid: comparison of three automated techniques. Ann Biol Clin. 69(4): 441-6.
  • Size / Price
    Каталог: HG12177-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».