Быстрый заказ

Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AFG3L1P Информация о продукте «Клон cDNA»
Размер кДНК:381bp
Описание кДНК:Full length Clone DNA of Homo sapiens AFG3-like AAA ATPase 1, pseudogene with N terminal His tag.
Синоним гена:AFG3, AFG3L1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16495-ACGRBS15400
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16495-ACRRBS15400
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16495-ANGRBS15400
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16495-ANRRBS15400
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16495-CFRBS13340
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16495-CHRBS13340
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16495-CMRBS13340
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16495-CYRBS13340
Человек AFG3L1P Джин клон кДНК в вектор клонированияHG16495-GRBS5130
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16495-NFRBS13340
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16495-NHRBS13340
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16495-NMRBS13340
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16495-NYRBS13340
Человек AFG3L1P Джин ORF экспрессии кДНК клона плазмидыHG16495-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16495-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.